Journal: Cell reports

Article Title: Regulation of Claspin by the p38 stress-activated protein kinase protects cells from DNA damage.

doi: 10.1016/j.celrep.2022.111375

Figure Lengend Snippet: Figure 6. Claspin phosphorylation upon cisplatin treatment is important for cell survival (A) Cisplatin induces Claspin phosphorylation. Western blot of HEK293T cells stably expressing ClaspinWT or Claspin9A upon cisplatin (20 mM for 8 h) or 5-FU (10 mM for 8 h) treatments. (B) U2OS cells stably expressing ClaspinWT or Claspin9A were plated in six-well plates (1,000 cells/well). Twenty-four hours later, cells were pre-treated with 0.5 mM p38 inhibitor (BIRB 796) for 2 h and then 2 mM cisplatin treatment was applied for 24 h while maintaining the kinase inhibitor. Treatments were washed out and cells were incubated for 1 week before crystal violet staining. (C) Colony quantification from (B) was carried out using ImageJ and values were normalized to untreated samples.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HEK293T ATCC Cat # ACS-4500 Experimental models: Organisms/strains S. cerevisiae strain BY4741 ATCC 201388 Oligonucleotides siRNA8 aClaspin GCACAUACAU GAUAAAGAAdTdT Thermoscientific TMOSLR-001156 Scrambled siRNA GAAUAAACA CGAAGCUAUAdTdT Thermoscientific TMOSLR-004650 siRNA ap38 CCAGACCAUUUC AGUCCAUdTdT Thermoscientific TMOSLR-001321 Primer to amplify mCherry (for Claspin expression) Fw AGAAGAGGATCCCATGGTGAG CAAGGGCGAGGAG Sigma-Aldrich (in-house designed) N/A Primer to introduce mCherry (for empty control expression) FwGA GAGACTCGAGACCATGGTGAG CAAGGGCGAGGAG Sigma-Aldrich (in-house designed) N/A Primer to amplify mCherry RvTAT ATTGCGGCCGCCTACTTGTACA GCTCGTCC Sigma-Aldrich (in-house designed) N/A Primer to amplify GFP FwTTGGTT GGAGATCTACCATGGTGAG CAAGGGCGCCGAGCTGT Sigma-Aldrich (in-house designed) N/A Primer to amplify GFP Rv TTGGTTGGAGATCTCTTGTACA GCTCATCCATGCCGT Sigma-Aldrich (in-house designed) N/A Recombinant DNA pcDNA3 Invitrogen Cat # V79020 pAcGFPN1 Clontech Cat # 632497 pEFmlink-MKK6DD (Alonso et al., 2000) N/A pcDNA3-3HA-p38a Provided by Dr. Engelberg (The Hebrew University of Israel) N/A pcDNA3-flag-p38a (Enslen et al., 1998) N/A p38a-DSRed (Ferreiro et al., 2010a) pGEX2T1-MKK6DD (Gubern et al., 2016) N/A pGEX5x3-p38a (Gubern et al., 2016) N/A pBS34-mCherry Addgene 83796 p426GAG (PGAL1-GST, URA3, 2 micron) (Christianson et al., 1992) N/A pcDNA3-2xHA-Claspin (siRNA resistant) (Semple et al., 2007) N/A pFRT-TODestGFP_RNAseH1 Addgene #65784 GST-MKK6DD (Gubern et al., 2016) N/A GST-p38a (Gubern et al., 2016) N/A GST-Claspin This paper N/A GFP-ClaspinWT and GFP-Claspin9A (siRNA resistant) This paper N/A Software and algorithms CellQuest Becton Dickinson N/A FACSDiva NIKON INSTRUMENTS INC N/A NIS elements AR software Nikon N/A (Continued on next page) Cell Reports 40, 111375, September 20, 2022 e2

Techniques: Phospho-proteomics, Western Blot, Stable Transfection, Expressing, Incubation, Staining